|
Synthego Inc
sgrnas targeting exon 2 Sgrnas Targeting Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/sgrnas/pmc13198606-31-2-21 Average 86 stars, based on 1 article reviews
sgrnas targeting exon 2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Synthego Inc
sgrna targeting exon 2 Sgrna Targeting Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/sgrna/bio_rxiv__64898__2026__04__22__720112-194-1-10 Average 86 stars, based on 1 article reviews
sgrna targeting exon 2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
sacas9 site 2 sgrna Sacas9 Site 2 Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/pSPgRNA+(Plasmid+%2347108)/pm41832601-359-15-34 Average 96 stars, based on 1 article reviews
sacas9 site 2 sgrna - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Synthego Inc
pif1 exon 2 sgrna ![]() Pif1 Exon 2 Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/3+5+cugauggugacgaagucgcg+pif1/pmc13065848-323-4-3 Average 86 stars, based on 1 article reviews
pif1 exon 2 sgrna - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
pespcas9 1 1 2xsgrna ![]() Pespcas9 1 1 2xsgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/peSpCas9(1%2E1)-2%C3%97sgRNA+(empty%2C+donor)+(Plasmid+%2380768)/pm41707379-40-21-23 Average 93 stars, based on 1 article reviews
pespcas9 1 1 2xsgrna - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
sgrna 2 ![]() Sgrna 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/SUCROSE+EP%2FBP%2FNF+12KG/pmc13004905-260-10-30 Average 99 stars, based on 1 article reviews
sgrna 2 - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Synthego Inc
sgrna 2 aaguuuucuuugguuauaag ![]() Sgrna 2 Aaguuuucuuugguuauaag, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/2+aaguuuucuuugguuauaag+sgrna/pmc12887790-36-20-15 Average 86 stars, based on 1 article reviews
sgrna 2 aaguuuucuuugguuauaag - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
human gecko v 2 sgrna library ![]() Human Gecko V 2 Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/Human+GeCKO+library+(Pooled+library+%2351241)/us12534762-247-13-18 Average 93 stars, based on 1 article reviews
human gecko v 2 sgrna library - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
crispra sgrnas targeting genes ![]() Crispra Sgrnas Targeting Genes, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna+2/pCHKU42%2E1-2%2E2+(Plasmid+%23110672)/pmc12837743-103-0-17 Average 94 stars, based on 1 article reviews
crispra sgrnas targeting genes - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Journal: Nature Communications
Article Title: Mitotic microhomology-mediated break-induced replication promotes chromoanasynthesis
doi: 10.1038/s41467-026-70086-y
Figure Lengend Snippet: a Telomere fusion blot showing telomere fusion amplicons from RPE1 WT cells transfected with control siRNA (Con), PIF1 KO cells transfected with PIF1 siRNA (PIF1) and POLD3 heterozygote cells transfected with POLD3 siRNA (D3) (ins insertion, del deletion). This experiment was repeated independently with similar results for three times. b Bar chart comparing telomere fusion molecules. Data plotted are means +/- s.e.m (n = 3 biological replicates). P values were obtained as described in Fig. . c Scatter plot showing the size of individual DNA insertions from three biological replicates (n = 5531, 4560, 1564, 1481, 454, 1880 from left to right, dotted line = median). P values were obtained using two-tailed Mann–Whitney test. d Telomere fusion blot showing telomere fusion molecules from RPE1 WT cells transfected with control siRNA (Con) or PCNA siRNA (PCNA) (ins insertion, del deletion). This experiment was repeated independently with similar results for three times . e Bar chart comparing telomere fusion molecules with no insertion, simple (1 or 2) insertion or complex (3 or more) insertion. Data plotted are means +/- s.e.m (n = 3 biological replicates). P values were obtained as described in Fig. . f Scatter plot showing the size of individual DNA insertions from three biological replicates (n = 1478, 1514, 480, 510 from left to right, dotted line = median). P values were obtained using two-tailed Mann–Whitney test . g Telomere fusion blot showing telomere fusion molecules from RPE1 WT cells treated with a WEE1 inhibitor together with DMSO or nocodazole (NOCO) (ins insertion, del deletion). This experiment was repeated independently with similar results for three times. h Bar chart comparing telomere fusion molecules. Data plotted are means +/- s.e.m (n = 3 biological replicates). P values were obtained as described in Fig. . DMSO controls were the same as in Supplementary Fig. . i Scatter plot showing the size of individual DNA insertions from three biological replicates (n = 5649, 4726, 1522, 1340 from left to right, dotted line = median). DMSO controls were the same as in Supplementary Fig. . P values were obtained using two-tailed Mann–Whitney test. Source data are provided as a file.
Article Snippet: Briefly, 100 pmol
Techniques: Transfection, Control, Two Tailed Test, MANN-WHITNEY
Journal: Nature Communications
Article Title: Mitotic microhomology-mediated break-induced replication promotes chromoanasynthesis
doi: 10.1038/s41467-026-70086-y
Figure Lengend Snippet: a , b At dysfunctional telomeres or DNA double-strand breaks (DSBs), DNA ends utilise the strand annealing activities of RAD52 and Polθ to bind to exposed DNA with microhomologies in mitosis and initiate end bridging DNA synthesis by Polθ. c The DNA synthesis initiated is short but become more processive following polymerase switching to Polδ and the recruitment of processivity factors POLD3, PIF1 and PCNA. d – f MM-BIR initiated is highly unstable, leading to frequent inter-chromosomal, inter-strand, or intra-strand/fold-back template switching, and this process appears to continue until the DNA is ligated with another DNA end or stabilised by telomere addition. g , h LIG1/3 is required at the final telomere ligation step and could also contribute to joining discontinuous DNA synthesised on the second strand by Polδ.
Article Snippet: Briefly, 100 pmol
Techniques: DNA Synthesis, Ligation
Journal: International Journal of Biological Sciences
Article Title: The castration-resistant prostate cancer-associated SNP rs11067228 facilitates neuroendocrine differentiation through an enhancer-mediated chromatin interaction with SRRM4
doi: 10.7150/ijbs.124731
Figure Lengend Snippet: The rs11067228 risk enhancer is a hub for intra- and inter-chromosomal interactions. (A) Circos plot showing genome-wide interactions indicated by curves extending from the enhancer bait locus. For each curve, cis-interactions are depicted in orange and trans-interactions are depicted in blue. Interactions reproducible in two biological replicates are shown. (B) Comparison of fold-changes in gene expression based on RNA-seq and corresponding 4C-Seq signal counts. Boxed genes indicate overlapping down-regulated genes in enhancer KO relative to WT lines with numbers of genome-wide interactions, as indicated by 4C-Seq (log2fold-change < -1.3; p-adjusted value <0.05). (C) Real-time qPCR validation of transcript levels of potential target genes of the risk enhancer based on analysis in enhancer KO cells. Shown are means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (D-G) 3C-PCR and sequencing confirmation of interaction of the rs11067228-associated enhancer with loci harboring NFASC (D), UGT2B15 (E), TBX3 (F) and SRRM4 (G) genes. Chromatograms confirm respective enhancer and target gene sequences flanking a HindIII linker sequence. M: marker. G-DNA: Genomic DNA, serving as PCR template. 3C: PCR products amplified from the DNA fragments in the 3C library. Forward and reverse PCR primers were designed based on sequences at both enhancer and target gene regions, respectively. (H-O) RT-qPCR and western blot analysis validation of mRNA levels of 4 target genes in WT 22Rv1 cells, 3 enhancer KO lines and enhancer-KO cells subjected to CRISPRa to overexpress indicated target genes individually. Data represents means ± S.E.M. of three independent experiments. *** P < 0.001.
Article Snippet:
Techniques: Genome Wide, Comparison, Gene Expression, RNA Sequencing, Biomarker Discovery, Sequencing, Marker, Amplification, Quantitative RT-PCR, Western Blot
Journal: International Journal of Biological Sciences
Article Title: The castration-resistant prostate cancer-associated SNP rs11067228 facilitates neuroendocrine differentiation through an enhancer-mediated chromatin interaction with SRRM4
doi: 10.7150/ijbs.124731
Figure Lengend Snippet: UGT2B15 and SRRM4 are essential for the development and maintenance of neuroendocrine differentiation of PCa cells. (A, B) Results of soft agar colony formation assays of WT 22Rv1 cells and three lines each of enhancer KO lines, plus enhancer KO cells subjected to CRISPRa to re-express either UGT2B15 (A) or SRRM4 (B) (left). Scale bar =100 μm. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001. (C, D) Transwell assays of cells described in (A, B) (left). Scale bar =100 μm. Cells migrated to lower chambers were stained with 0.1% crystal violet. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001. (E-H) LDH assays in enzalutamide-treated cells corresponding to those described in (A, B). LDH release was assayed after 24 (E, G) and 48 (F, H) hours of treatment. Data represent means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (I) MTS assays in enzalutamide-treated cells corresponding to those described in (A, B). Data represent means ± S.E.M. of three independent experiments. ***P < 0.001. (J) Western blot showing NE-related protein ( SYP , CHGA and CHGB ) expression in wild-type 22Rv1 cells, as well as three lines each of enhancer-deleted lines plus enhancer-deleted cells re-expressing (by CRISPRa) SRRM4 . (K) Real-time qPCR validation of transcript levels of NE-related genes in cells corresponding to those described in J. Data represent means ± S.E.M. of three independent experiments. ***P < 0.001.
Article Snippet:
Techniques: Staining, Western Blot, Expressing, Biomarker Discovery
Journal: International Journal of Biological Sciences
Article Title: The castration-resistant prostate cancer-associated SNP rs11067228 facilitates neuroendocrine differentiation through an enhancer-mediated chromatin interaction with SRRM4
doi: 10.7150/ijbs.124731
Figure Lengend Snippet: SRRM4 knockdown blocks PCa cell neuroendocrine differentiation. (A-G, R) Validation of target gene knockdown in PCa cells. Expression of indicated target genes, as measured by real-time qPCR and western blot analysis. sgRNAs targeting gene promoter regions were used in CRISPR-interference (CRISPRi) assays. Data represents means ± S.E.M. of three independent experiments. *** P < 0.001. (H, I) Soft agar colony formation assays in WT control 22Rv1 cells and in cells made deficient in indicated target genes using CRISPRi (left). Scale bar =100 μm. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001. (J, K) Transwell assays of cells described in (H, I) (left). Scale bar =100 μm. Cells that had migrated to lower chambers were stained with 0.1% crystal violet. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001. (L-O) LDH assays of enzlutamide-treated cells described in (H, I). Assays were performed after 24 (L, N) and 48 (M, O) hours of treatment. Data represent means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (P) MTS assays of enzlutamide-treated cells described in (H, I). Data represent means ± S.E.M. of three independent experiments. ***P < 0.001. (Q) Real-time qPCR validation of transcript levels of indicated NE-related genes ( SYP , CHGA and CHGB ) in cells made deficient in SRRM4 using CRISPRi. Data represent means ± SEM of three independent experiments. ***P < 0.001. (R) Western blot showing NE-related protein expression in cells made deficient in SRRM4 using CRISPRi.
Article Snippet:
Techniques: Knockdown, Biomarker Discovery, Expressing, Western Blot, CRISPR, Control, Staining
Journal: International Journal of Biological Sciences
Article Title: The castration-resistant prostate cancer-associated SNP rs11067228 facilitates neuroendocrine differentiation through an enhancer-mediated chromatin interaction with SRRM4
doi: 10.7150/ijbs.124731
Figure Lengend Snippet: SNP rs11067228 is a functional SNP in 22Rv1 cells. (A) Transwell assays in 22Rv1 cells homozygous for the non-risk (G/G, WT) versus risk (A/A, MUT) alleles of rs11067228. Scale bar =100 μm. Cells that had migrated to lower chambers were stained with 0.1% crystal violet. Quantification is at right. Data represent means ± SEM of three independent experiments. **P < 0.01. (B) Soft agar colony formation analysis of WT (G/G) versus MUT (A/A) 22Rv1 cells. Scale bar =100 μm. Quantification is at right. Data represent means ± SEM of three independent experiments. **P < 0.01. (C, D) LDH assays comparing WT (G/G) and MUT (A/A) cells treated with enzalutamide. LDH release was assayed at 24 (C) and 48 (D) hours after treatment. Data represent means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (E) MTS assays comparing WT (G/G) and MUT (A/A) cells treated with enzalutamide. Data represent means ± S.E.M. of three independent experiments. **P < 0.01. (F) Real-time qPCR validation of transcript levels of indicated NE-related genes in WT (G/G) versus MUT (A/A) cells. Data represent means ± SEM of three independent experiments. ***P < 0.001, **P < 0.01. (G) Heatmap of differentially-expressed genes in two samples of 22Rv1 cells harboring the non-risk (G) allele (WT) and two groups of MUT cells harboring the risk (A) allele, based on RNA-seq (|log2fold change| >1 and p-adjusted value <0.05). (H) KEGG pathway showing biological processes of genes upregulated in MUT relative to WT cells (Top 10). (I) Overlap of genes down-regulated in enhancer KO versus WT lines (p-adjusted value <0.05) (green), with the number of genes up-regulated in lines harboring MUT (A/A) versus WT (G/G) cells (log2fold-change >1; p-adjusted value <0.05) (blue). (J, K) Real-time qPCR and western blot analysis validation of transcript levels of indicated target genes of the risk enhancer in MUT and WT cells. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (L) Real-time qPCR validation of transcript levels of EMT-related genes in WT (G/G), enhancer KO, and MUT (A/A) cells. Data represent means ± SEM of three independent experiments. ***P < 0.001, **P < 0.01, *P < 0.05. (M-O) Photograph showing 22Rv1 xenografts in nude mice with WT (G/G), enhancer KO, enhancer KO cells subjected to CRISPRa to re-express SRRM4 and MUT (A/A). Tumor volume was measured once a week at indicated time points. Tumor weight was measured when sacrificed (n = 6 per group). Data represent means ± SEM of three independent experiments. ***P < 0.001, **P < 0.01, n.s., not significant. (P) Representative immunohistochemistry staining of indicated 22Rv1 xenografts in (M). Scale bar =100 μm.
Article Snippet:
Techniques: Functional Assay, Staining, Biomarker Discovery, RNA Sequencing, Western Blot, Immunohistochemistry
Journal: International Journal of Biological Sciences
Article Title: The castration-resistant prostate cancer-associated SNP rs11067228 facilitates neuroendocrine differentiation through an enhancer-mediated chromatin interaction with SRRM4
doi: 10.7150/ijbs.124731
Figure Lengend Snippet: The transcription factor SOX4 preferentially bind to the rs11067228 risk allele to modulate target gene expression. (A) Schematic showing DNA-protein pull-down assays and mass spectrometry (MS) analysis to identify TFs binding to the rs11067228 risk allele. (B) Overlap in the number of TFs significantly enriched at the risk (A) relative to non-risk (G) allele (orange) with numbers of predicted TF motifs analyzed in the JASPAR database (blue). (C) The sequence of a potential SOX4 binding motif differs in the risk (A) versus non-risk (G) alleles of rs11067228. (Upper) Predicted preferential SOX4 binding site, based on the JASPAR database. (Lower) Shown are actual sequences of non-risk and risk alleles. (D) Quantification of ChIP-qPCR analysis showing SOX4 enrichment at the rs11067228 locus in indicated WT (G/G) versus MUT (A/A) cells. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001, n.s., not significant. (E) Quantification of ChIP-qPCR analysis showing H3K27ac enrichment at the rs11067228 locus in indicated WT (G/G) versus MUT (A/A) cells. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001, n.s., not significant. (F) Transwell assays of MUT 22Rv1 cells and two lines each of SOX4 knockdown lines, plus SOX4 knockdown cells subjected to CRISPRa to re-express SRRM4 . Cells migrated to lower chambers were stained with 0.1% crystal violet. Scale bar =100 μm. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01, *P < 0.05, n.s., not significant. (G) Results of soft agar colony formation assays of cells described in (F) (left). Scale bar =100 μm. Quantification is at right. Data represents means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01. (H, I) LDH assays in enzalutamide-treated cells corresponding to those described in (F). LDH release was assayed after 24 (H) and 48 (I) hours of treatment. Data represent means ± S.E.M. of three independent experiments. ***P < 0.001, **P < 0.01, *P < 0.05. (J) Real-time qPCR validation of transcript levels of NE-related genes ( SYP , CHGA and CHGB ) in cells described in (F). Data represent means ± S.E.M. of three independent experiments. ***P < 0.001.
Article Snippet:
Techniques: Targeted Gene Expression, Mass Spectrometry, Binding Assay, Sequencing, ChIP-qPCR, Knockdown, Staining, Biomarker Discovery